Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ493649
Length 572 bp
Fasta Format > whfl10a17
gccccttactcgcagaaaccctagcagatcgctcgagccctccgccgccg ccgcgccttcagctctctccttccttcaccgattcaagatgaagttcatc gctgcctatctgcttgcttacctctctggcaacgccagcccctctgcaga ggacctgacatccattcttgagtcagttggttgtgaaatcgacaatgaga agatggaactcatgctgtcccaagtgaagggcaaggacatcactgagctc ttggctgctggtagggagaagtttgctgcggttccatctggcggtggtgg gtgtggctgtttcagccgctgctcctgctgctggtggtgctgctgcccct gcagctgagtcgaagaaagaagagaaggtcgtggagaaggaagagagtga tgatgacatgggcttcagtctgttcgactaagtcgtggggcatcttgtgt ctgcagtatctatccttggccaggaaactanagtcaatgatgttttancc tttatttanctgagttgtgaaacgctggcaagacaatgttttgatatgta attcancccctggttgctggtt
Download
page-top