Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ493647
Length 462 bp
Fasta Format > whfl10a15
agaaaccgcagaccgcaccaccaccgctccccatctcgatctaaagccga gggtttcgtccagctccgtcgccgcgacccaagccagagccagccccacc ccagccagccagccatgccgaagaacaagggtaagggaggcaagaaccgc aagaggggcaagaacgaggccgacgacgacaagcgcgagctggtgttcaa ggaggacgggcaggagtacgcgcaggtgacgcggatgctcggcaacgggc gctgcgaggccatcttgcgtcgacggcaccaagcgcctctgccacatccg gggcaagatgcacaagaaggtctggatcgccgccggggacatcgtcctcg tcggcctccgcgactaccaggacgacaaggccgacgtcatcctcaagtac atgaacgacgaggcccgcctgctcaaggcctacggggagctccccgacac gctccgcctcaa
Download
page-top