Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ319399
Length 607 bp
Fasta Format > rwhyf8e07
tcctaggcatgaaaggctgccctctaggtacaccacgaattgattcgagt atgatacaacagagacaacacgcggacaagaagacaacaggctgggccaa cgcttccatccatccatgtacaagagagcagatgtcggcgcgcagctgac ggggtcgacaacaccatcaaaactccctgtgcgccacttgcagtattgtg agcgcctctcctcttgaacatcgctcgtagagctctgaggcgagctcgag gagagactcggtctcctcggccatcttgccgatcctttcaacctccatca tgtgctcgtttgcgaggtgcgatttggcctccgcgtccgctactttcatc gctgcagcttcagctgcgtccagtgcaggactcgactggcctagaccctt tgctgccttggatgacttggctgaatccttcttctttagagatggatctt tcattggagccagagccctttttgcatatgaatccgtcagcttataggac ttatcaatcttctcaactttgttcacgcctataagccttcgtaatttggc acaaagcaaccttctaaaatttggntgcacctcatgcctttgctctatga aattgca
Download
page-top