Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Accession HX144973
Length 822 bp
Fasta Format > whxs_20015_b02f
TCCGCGAGGACCATCGCAATGCTTTGTTTTAATTAAACAGTCGGATTCCC CTTGTCCGTACCAGTTCTGAGTCGACTGTTTCATGCTCGGGGAAAGCCCC CGAAGGGGCGATTCCCGGTCCGTCCCCCGGCCGGCACGCGGCGACCCGCT CTCGCCGCGTGAGCAGCTCGAGCAATCCGCCGACAGCCGACGGGTTCGGG GCCGGGACCCCCGAGCCCAGTCCTCAGAGCCAATCCTTTTCCCGAAGTTA CGGATCCGTTTTGCCGACTTCCCTTGCCTACATTGTTCCATTGGCCAGAG GCTGTTCACCTTGGAGACCTGATGCGGTTATGAGTACGACCGGGCGTGAA CGGTACTCGGTCCTCCGGATTTTCATGGGCCGCCGGGGGCGCACCGGACA CCGCGCGACGTGCGGTGCTCTTCCGGCCACTGGACCCTACCTCCGGCTGA ACCGTTTCCAGGGTTGGCAGGCCGTTAAGCAGAAAAGATAACTCTTCCCG AGGCCCCCGCCGGCGTCTCCGGACTTCCTAACGTCGCCGTCAACCGCCAC ATCCCGGCTCGGGAAATCTTAACCCGATTCCCTTTCGGGGGATGCGCGTG ATCGCGCTATCTGCCGGGGTTACCCCGTCCCTTANNATCGGCTTACCCAT GTGCAAGTGCCGTTCACATGGAACCTTTCTCCTCTTCGGCCTTCAAAGTT CTCATTTGAATATTTGCTACTACCACCAAGATCTGCACCGACGGCCGCTC CGCCCGGGCTCGCGCCCCGGGTTTTGCAGCGGCCGCCGCGCCCTCCTACT CATCGGGGCATGGCGCTCGCCC
Download
page-top