Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Accession HX121025
Length 622 bp
Fasta Format > whxq_19067_m18f
ACCTCCCACCTTAGCAGCGCAATGGCGACCACCACCATGTCCCTCTCCTC GACCTTCGCCGGCAAGTCGGTGAAGAACGTGGCTTCATCAGCTCTCTTTG GTGAGGCCCGTGTCACTATGCGCAAGACCGCTGCAAAGGCCAAGCCGGTT TCATCAGGCAGCCCATGGTACGGTGCCGACCGTGTGCTCTACCTCGGCCC GCTTTCCGGAGAGCCCCCGAGCTACTTGACCGGCGAGTTCCCCGGCGACT ACGGATGGGACACCGCCGGGCTCTCGGCCGACCCCGAGACCTTTGCCAAG AACCGGGAGCTCGAGGTGATCCACTGCCGGTGGGCCATGCTCGGTGCGCT TGGATGCGTCTTCCCCGAGCTTCTTGCACGCAACGGCGTCAAGTTCGGTG AGGCGGTATGGTTCAAGGCCGGTTCCCAGATCTTCAGCGAGGGTGGCCTC GACTACCTGGGCAACCCCAGCCTCGTGCACGCACAAAGCATCCTTGCTAT CTGGGCATGCCAAGTCGTGCTCATGGGCGCTGTTGAGGGGTACCGCATTG CTGGCGGCCCACTCGGTGAGNTAGTCGACCCACTCTACCCCGGGGGCAGC TTCGACCCACTGGGCTTGGCTG
Download
page-top