Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ321897
Length 705 bp
Fasta Format > rwhyf22n06
gcttcgtattcttaccttaaactctggcaagttccatccgataaaaatga agaaaaatatcagtccccaagcatcaaatagactggcacaacagaccatg ctaacagtttacacagttacagtggcttcgacctcttgcagtctgagggt aacagctcgcttgtgcgcttctagcccttcgacttctgccatctttgcga cgtaggggcccagccttctcagcccttcttcagtcagggattgaacagtg atgtacttgaggaaagagttcagcgacacaccgctgtacatcctcgcgta accgtaggttgggaggacgtggttcgtcccactggcatagtcacccacgc tctcgggggtccattgtcccaagaaaactgaccctgcgttctcgatgagc tcctcccattgctcagcatcctttacgttgatgatcaaatgctcaggagc atacatatttgagaacgataatgcctcaaccatatctctggcaaacacag tgaaactgtggccaagtgctttggaagcaaagtcgcctctaggaagagca tcgcactgcttgctaacttctgcttcaatggcacctaaatcaacaccatc tccagcaataactagaacaacctgactatctgggccatgttctgcctgag atagcagatcagcggcaacatgaactgggttggcatatttgtcagcaatt accag
Download
page-top