Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Accession HX114868
Length 454 bp
Fasta Format > whxq_20025_h05r
CCGGAGTCCTTGGGCACTGACATTACATGACCTTGATGAACTGTTCCTAC TAACTACAATAGAGTACATAACATAAATACATAGTATATATGCCCCTAAA AAACATACTGTAGAATATACATAAAAACACATGACGTATGCAAAATCTTT GCTCGAAGCAGAAAGAATCCACCTTCAGCTAGCTGTTGTACACTCTAATC ATCCGTACATGGCACAGCGTGGCCTAGAAGGCCGGACAAACCTTCCTGAT GATCCAGAGAATAATGCCCCATATGAGCTCATTTTCTCTGGCCTTCACAT GATGCTCATGGCTCCTCGCACTGATGTTTCTTCTCTGAAGCTGGCTCCTG AGAGCAATGGCCTCCACTGCCTCGTACACCATTATTTCTCTCCCGGGATG CTGCCGCAGATGCTAGCTAGTTGGACACAGAGTGAAGAAGAGACTGGTTC CCGG
Download
page-top