Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ217960
Length 689 bp
Fasta Format > rwh29f12
gtcgaatngattttccntaaagagcagcagtttgtgatntcagatgttta aaacgccaacgaaacctacatcccagtgctagtttcaacagagagacaga acctccaatcccgcaactgcaacattcaagatggcataccaaaagactgc tttgctatccaagaccctattatcaggacacaattccacctttgggcacc tacctagttagtcaactccatgatggcgctgacgatgtcaccgcccgcag ccttgagcgccttcacggccctggatctcggcacggaggcctgcatcatc acgagctcaacgtccttcttgtcaacaccagtctcatcaacctcctcgtc gtcatgggctgctgccatggacggctcgcccttcaagatgacgctgcttg ggctcggcgccttgaactgctccgccgcttgtgaatgcagctgagtgctc aggtcctcaatcttggcctccccgaacatgacgtaggtatctgagtttga gctcttgaagacatctggcttggagaggacaaacataacgctcttgttct tcttgatagttacacggctcacaccagtaatgaccttcatgccaagcttc tccatggctttcctgctcttcttctcactcctactctgcctagatcttcc actagcatcacctcccgcaacgtcatcgtcatctttttc
Download
page-top