Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Accession HX112126
Length 603 bp
Fasta Format > whxq_24075_e18f
CTCCTGAAGCAGGTCGACTACTTGATCCGCTCCAAGTGGGTGCCCTGCCT CGAGTTCAGCAAGGTTGGCTTCGTTTTCCGTGAGCACAACAGCTCCCCCG GGTACTACGATGGTCGATACTGGACAATGTGGAAGCTGCCTATGTTCGGG TGCACCGACGCCACACAGGTGCTCAACGAGGTGGAGGAGGTCAAGAAGGA GTACCCTGACGCCTATGTCCGCGTCATCGGCTTCGACAACCTGCGCCAGG TGCAGTGCGTCAGCTTCATCGCCTTCAGGCCACCGGGTTGCGAGGAGTCT GGCAAGGCCTAAACTACGAGTTGAAACAATGGCCTATGTATGAAGGTCTT TTGTGAACTTAACTTTTGTCCACCACTCTGCTGGACGACCAGAGCATATT TTTCATTCTATATGGTCTGTGTGTGTATGTACGAACATAGGTTCTCGAGC ATGCATATGTAAATTCTAGAACCGGCTACACATATACAAAACCTGTGTGA TATTTATTATATACAAACACGCGGACCATTGTCTTGCTGTTATTAATTCA GGAAAAGTTTCTTTATTTGGCACTGCAATGAATATGTCTCACAACTAGTT GTG
Download
page-top