Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ321027
Length 718 bp
Fasta Format > rwhyf18m05
cttaaactatactccaataaaaatggtagccgagtgttacaaacagcggc catcacaggaccaagcgttctgattactcaagggaaactaagcgtaataa ttcaagctggacttcttctttgcttgcacttggataatgccttcgttgaa atcttcatggatcacctctgtagcgtccctgcgtagagcaagcatgccag cttccacacaaacagccttcagttgtgcaccgttgaaatcatcagttgaa cgagccagctcctcaaagttgacatcaggatgtacgttcatctttcttga gtgaatttgcaaaatccgagctcttgcttcttccgtcggatgagggaact caatctttctgtccaggcgaccagaacggagtaaagcaggatcgagaata tctgcacgattggttgcagctatcacctttatcctctcatcaataaaaat gatgcagggggccttctcctttgccaactcaaaggcatctcggacaagct ttgccccatcaccgatgaacatctggactagctgcggaccagcaagtttc agaaaggttgcattggtttgtgcagcacatgcacgagccattcaacgtct ttcccgtcccaggtgatccatataaaagaactcctttcgggggacggatt cccaacttctgaaattgctccttggtgtgtcattggcaacactatagctt caacgagttcctgaatct
Download
page-top