Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ319881
Length 634 bp
Fasta Format > rwhyf17i18
ttcgattgcatcaaattatgaaagtgtgcggcgatatggtaggcaatgga gccaccgagcccctttgctaagtaacaactacaaaattccaataacataa gaaaccacgacacaagcgcctactgcaggaccctccctctgacttatatg atgccgatcttgttggccacatcaagagcatcgtagtctggtgtcagctt cacgtacgccttcttcttgccatcaggcctgatgagggtgttaaccttct tggcctgaatgtcgtacattttcttgacagcggccttaatcttcttcttg tcggccttcaggtcgacgatgaagacgagtgtgttgttgtcctcgatctt cttcattgcagactcagtggtaagcgggtacttgaggatctgatattgat cgagcttgttcctcccaggggtgctgatcctggggtacttggggtccctg gccttggacagggtcttggggcggtgaaatgtcacagaagtgcggatctt ctttgccgtcttcttgattgacccagacttcacagccttggcaaccttgg cggcctgggccttggcatcgcccttcttggcaacagcaactttgggagcc atttgagcttctcaggacagcccttgaacttacc
Download
page-top