Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Accession HX106763
Length 352 bp
Fasta Format > whxp_32081_p22r
TTTGATTTGGGACCTTATGTTCTGCCGACCGTAGGGAGGCCCCTTCCTAG ATCTTGTCGAGCTTCTCCGCCTTCACCACCGGGTTGGCCTTGGCGATGGC GTCCATGGCCGCGGCGCGGTNNNCAAACTTGCACTCGTGCTTGTCCGAGT AACGGTGCGTCGCGCNNTACAAGTTCCCGCACCGGCAGTTGAATCCGGTC AGCCCAACCCTCTTTCTGCNNNTGCTGCACCGGCTTGGGCCTTTGGGGTT CTCCATCGCCGCCTCGCTGGGACCGGCGATATCAGCAGGCTGTGCGGTAA TAAGCGTCTTNGCCTCAACGTGAGCAACTGCCACCGCCGTGCTGCCAGCA GC
Download
page-top