Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ320285
Length 392 bp
Fasta Format > rwhyf14g20
ttcgattgcatnaaattatgaaagtgtgcggcgatatggtaggcaatgga gccccgagcccctttgctaagtaacaactacaaaattccaataacataag aaaccacgacacaagcgcctactgcaggaccctccctctgacttatatga tgccgatcttgttggccacatcaagagcatcgtagtctggtgtcagcttc acgtacgccttcttcttgccatcaggcctgatgagggtgttaaccttctt ggcctgaatgtcgtacattttcttgacagcggccttaatcttcttcttgt cggccttcaggtcgacgatgaagacgagtgtgttgttgtcctcgatcttc ttcattgcagactcagtggtaagcgggtacttgaggatctgc
Download
page-top