Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ320143
Length 661 bp
Fasta Format > rwhyf13l04
gatctattcttacatgatttaacacatgaaacatcatcatatctcataag atccaagctaaacacagagtcttcttcatgggcaataccaaaacaggaca ccttaagcgcagcaacagtcaccgataacaagcaactaaaaatgtaaagg gttcgggtagtaataacggcagagaccgccctggcgcggccggccggcct agaagcggagcttggtgaagaaccacctgttcttgccggtcttgaacctc tcctcgagcttggccttggcggccttggcggcgcccaccttcttgtcctt ggaggtgagggagtcgggcgcgccggaggccacctccttgaggtcgacgt cgagggtatagcgggtgggcatgagatgggtgaagttgacgagcttgagg aacaccttgacgcgggacttcttggccgtcttcttggccgagtccttgcg gatcaccttcttcgggtacttggccagcccggcgacgaggcagtgcccgt acgggcggtcgcgggtgccctcctcgaacacgcgcacgatcaccgccttc ttccccgcgtacctgccctgcagcaggatcaccgccttgccgggcttcag gaacttcaccatcttcgcttccttcctcaagctgcgctgcgccgccgccg gtgggttgggc
Download
page-top