Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Accession HX096464
Length 548 bp
Fasta Format > whxp_35039_i10f
ACTCTCCCCCTCCGCCGCCGGCGCAGCGTCCTCCCCGCGACTCCGATGGC CAGCAAGTGGGTCAGGCCCGAGGTGTACCCGCTGTTCGCGGCGACGGGCG TCGCCATCGGCATCTGCGCCTTCAGCCTCCTCCGCAACATCACCGGCAAC CCAGAAGTCAGGGTCAACAAGATGGGGAGGGCAGCGGGAGTGCTTGAGAA CCATGAGGAGGGCAGGCGCTACGCCGAGCATGGCCTCAGAGCCTATGTGC AGGACAAGACCCCCGAGATCATGCCAGGAATCAACAAGTTCTTCACCAGC CCGAAATGAAGCACTTTAGCCTGTCAGTGGCTCGCTATTAGTAACTGTTG TGGTCAAGTGCAAACCTATTTCAAGCATTCAGTAATGTTGTCGCGTCCAT AATTCAGAGGATATCATCAAGTGCCTCTTATTGAAAGAACCATGTGATGT TTGATGGCTTGCTATATATGTGATGGTTGATGGCTTCTAAATATCTGTTT CATTGAAATTGTGGATATTCCATGCTTCCATTTAGTTGAAAAAAAAAA
Download
page-top