Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ318201
Length 713 bp
Fasta Format > rwhyf10h10
cacaaataatggcactgcgaataaatttagcgtgctaatcatggtttaac agaggaaatgctaactaaggtagaaatccagcaagaataatcatttagtt ccattatcaacatgtatctgtgtaaatcatccatgccaaaatgtgttgct gctgggatagtcactactgaaactttcaagatcaacttctttgaacattt tcattggctagctttaggaaacggcaagttcatggccgtctccatcggct gcgggctgaacccgaaagagagctacagcgccaaggacgccgccaagtgg gggatcctgaactgaatcgtcaaggatggcactgcccccatcgtcgacat gttcaatgtcgccagcgccgacatgatggacataagcagctaaagctgta gagatgcattaacacaaaaacacaagataattcccaacgaaaaactgaca agagcatgaactcatttgtatacaccctctgttttctccacaagatattc ctctgcttatgagttaacatgtgcaaattcatgaacaaattgaaaaatgc ccaatggaagaaaacacaaaactgcacctctaaattggtactccctccgt tccaaattacttgtcataaaaatggatgtatctagaactaaaatacatct agatacatccatatctgcgagaagtaattcggaacgaaagggagtacttc aaaattacatacc
Download
page-top