Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ318196
Length 619 bp
Fasta Format > rwhyf10g22
ctggtggatgcctatnaggnaattttttgcgataaattgcacaggttggc gaacaaacaaagagtctgcagcatcatcatttgatgttcattgtttcaac ataaatccctgaacaagttctttgctgccagagtcgcccttccttaacca tagttcaggcggaacatgtcgttctgcacgtagaagctccctccagctgg cagcaaatggaacatctgtgagaacttgagggggtgctcgccggggccgg tggtgatggtgccggagacgaagacgaggacgccgccctggggccccgag ggctggcagtcgacggtgtcgatcttgtgctggcactgctggaaggggag agatccgagcttgccggcgatggcggcggggccgccgaacttctcgccct cgaaggtgagcatggagccgtcctggtacagccccaccagcgcggcgcgg ttggagtcgaacgtctggtagtagtgctgcacgaacgccttcgacaccga atcgggatccatggcctctccctcgccgcgccgcctcctcgcctcgcctc gcctcgcctcgcctagggtttggagctctggatgcggaggctttgggcgt tgggagcccggagtttggc
Download
page-top