Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ318194
Length 613 bp
Fasta Format > rwhyf10g18
gaaatggcctaggattaataaaccattgaaatcgccaaatntgagacggc cgcaccagagtggcaaaccaggaaacaacgtatgcactaatgcacagcgc acagcccgtgttacatagacaccgtacaaccagaaactagattgctagac taccattaatttggacttgcaaaatagagcaagctgttgtgaaccattct aatctctaccggcagttttacaagataacatctcctctgcctttcattcc acacgggtggaagcttctagcaaagggcacattccgtgcccctgtgaaat gtcatattgtccatactagactaatgcaaccaaaaaattcctatgttgcc gtgacgaaagctgcgctcattctcagcttcagaatccattcctgaagatc aattttacacgttcagtcaatatcacatccaagatatatatggctgtgcc caaagctttctcacttccagtcaagcttgcgggcttgaaagtttagcata ttatggatctagccttcattggagccaaacgtgattccttatccttgtag ctgcaaggaaagaccgggttgaagccaattgatggagaaaaatgactcat cctgctgtagaag
Download
page-top