Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ318192
Length 334 bp
Fasta Format > rwhyf10g16
agaaacaacaccgacgcccttcctctagtactgnaactngtcaaaaacgg agnttacatcaagggtcacaggcaaaaattgaccacgctgntccattacc ggattacctatangatgtatgaatggacaggcacagaaaacgnccttcga ggccgctgtggntggncagtgtctatgctctnctgtcatcgtcactgctt tcactgtcgtcactctccacaggaagctttgcaagtnttcttacttctaa gcctgtcatgttggtgagatgcttntgcgcagtantaacgtaatctgccn ctttggncaactggaaaacatgaacggcacanng
Download
page-top