Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ318184
Length 702 bp
Fasta Format > rwhyf10g03
agagacctcttaaaaaaaacaagctacagcacaaattctcaaatatataa ccttggtccttttatcagtagtactagtattatatcttgacttggttgtg ctggacaatatttcagcggaccagataaccagtgtaactaaacaaaagaa caaacataaacctttcgtgctcaatttatttttcattttgaaccttgccg cggctaagaatttgcatgttcaccaggtcaccgatgtcggccagggaggc cacctccaccaggcttgcggatgaaggtgtttttatttttcggcttgggt atgtcgtggatatccagcacttgcattgtcctctgttttttcgcattttg tgcttcctggtaattttcttgaagcctctttctggctgaatcgagcttct cgtccaaatgattatccttctgctccctcatcgccctagctggagcagat gacgaagtagttgaatagttattgccattgttctgcttcgtatgatacgt aggagctgggcttgctctatgcctctccagtgtcgactcgaacccattgt tattcctagaccgctctgaactcaaaccactgtgcctctgtggtgggctg ggcgtatacttgaagtctgaaacccgggcattttggtagcttttgccttg agtcttctcaggagagtcaccatcagttaggatcgaatttccaccgtcac ca
Download
page-top