Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ318183
Length 480 bp
Fasta Format > rwhyf10g02
cacttgactggaagctacaacagttacaggcgtagcacagacgcatttca aggacaccactgatcgctatgacccttgcagcatagatcagggaggcaca acgaagaaacaatataaaggaggggatcatccaggcgacgacaccaacca aatcaccccaaggaacaatacaaatactgaaacagggaaatggtgtaggc aaaccagataacatgcatattgaccaaggtgcgaagcaggttcaaacata ccacaggttgtaaaccaaacaccacacagcaaacattcaaacagacagac agcagataaagccactcgggcagatcacacgaaggaacgcttggcgtaca tcaggtcgttgaactcagcagctctagtactcatcaccctcatcaccatc ctcaccctcgtcgaactcagcgccaacttcttcatagtccttctccaggg cagcgagatcctcacgggcctcagagaacc
Download
page-top