Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ318178
Length 185 bp
Fasta Format > rwhyf10f18
ataatacttnctgaagnagcatacatctttgggttacataactcgaactg caaacttgatgaaaggaacggaaataataaaacggtaaacatagctagtc atcatcgatcagacggacggacggtcccaaatgggaaatgacaaccaaat ctaaaacgggaagagacaaaactagtaagcatgca
Download
page-top