Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ318177
Length 662 bp
Fasta Format > rwhyf10f17
cgattattgccagcagttnagcacaacaagcttacagatgatgggagaat acagttgcaggattttctgatgctcacaggcatcacgggataggaaacaa tccatagcttcaagcacttccaagttcttagtaatctttaggataaaaga gggtactccttagcacagggagaacaataacaggaaatcatctagcgttc aggaaatcaactcatacattcgcgatacatctcttgaaagggcgctcggc acacgaagccagggctgcagtgaaaaggacatgatatgtgggcagaattt ggccgtatctggcgccttctccagttcttcaggatcggcgcttgtcgccg tgcttcttgctcttcttccggctgcctttgccgtcagaatcggaatcaga ctcggactcagattcagatccagaggaggaggacgacgtgctatccctac ggtgccttctcttcttcagatcagggttcacaaactgagagggcgccggc agccacgccttcttcaacctggggtccttaagctgatccgtccttgaggg ccgcgatatgtagacccgttcattcttgcactcgtatgtccagtgcccag gctggaagcacttctgacattggcccccagcagttgcagaagctggtgca gcatttggcctc
Download
page-top