Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ318174
Length 387 bp
Fasta Format > rwhyf10f06
tncataatagacagaangatgttcatggttctccacgcggctatggaaat gttctcagaacatagaagatgnaacctcagcgacttcagttacaacctgc ttgtattctgattccagtttctccttcacctcttcagtgatctccccctt ggctggcttggtcatnaccaacacgcagcaggtgggcctcttggttgtcc ccgcagtcgcaagctcctcttttgaggtcacatatatgtatgggacatta gcttcctcacaaagtatggnaagatgtgtaatnacatcgatagganagat gtttccggcaattacacacaaccctttgctcccacggcggatgctnttga ccacctccttgaccccgcgcttcaggcacttggcctc
Download
page-top