Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ318166
Length 612 bp
Fasta Format > rwhyf10e11
tagctgtttgatttaggaagcagagttgacaaccctctggttaaatctga aggaagccgtgcatacacgagcagtattcaagttgtaaagtaaaataatg cacgaggacggcgatgtataacaatataacgaaagaaagggtaggtaaaa gaccaagcaacaaaggacacacgaaaatggtccttgtacaagcatcataa ctacccgaaggttaagagagaaagagggcagtagctaggacccttcacta ctgctcatcctcaggcttgcttgaatccctcatttcatcgccagcgtcat cctgcatatcagaggtccacaaggtgagattgtcacggagaagttgcatt atcagggtgctgtccttgtaggaatcttctccgagggaatccagctcagc gatggcttcatcgaaggcctgtttggcgagcgagcacgcacgatcaggcg agttgaggatctcatagtagaacacggagaagttgagcgcgaggcccagt ctgatggggtgagtcggtggcagctccttcatggctatgtcctgagcggc ctggtaggcaccgagggtggagtcagcggcatccttgcgctcggcggccg acttgaactccc
Download
page-top