Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ318165
Length 615 bp
Fasta Format > rwhyf10e10
gtacttaatttaggcgcgtagaaataagatcggtacttatatgtcggacc aacaaatcacgacacgcaaacatttgcatttgagctaagctcatactaca tccatgcaaacacagctagttaaactgcaaatccgacactagtacacacg actgacgacggtacaatctactggcacctcgttggaacacacaacagatt aacctgaaacagctgcaacattattcaacactactaagcaggtgcggcag ctagctagacgggcgatggatggatcgatctatgggttgtagtagacgat cttgatctcggtgacgccgtggcagttgccgccggggacggagtgctcga agcagtggttgccgctgttgcatccggcggtggggcagtgcccctgcagc gggcctcccgtgcggggtgacggagacgcggatgggcatgttggcctggt cggtgctcacctcgtagtacgccccgcccgtcgtggcccaggtggaactt ggccacggcggcgccctgcgccgacacgctcccggaccacgagcacacgt cgaacgactcgtgctttcccgttggggagcagccagccgttggggaagag gaccttgctgtccgc
Download
page-top