Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ318163
Length 686 bp
Fasta Format > rwhyf10e07
gcacacaaaaagactagaacagacttcctcgaaataagaacatctacaaa tcaagtagacactaaatcacacaccccgattcgatacgactataatagta ccaccctgaggaacatgaagccagcagagcaactattgctgacatacaca acgatgacccaggagtggagacagggtggccgcaagcttgatggcaaaca gcaaccatcttagtagcggtaagtggaaccgtaaccaccaagacctgacg atgaatatccactcccgtccatgttagaataagatggcagcgatgatgac gggtaggccgagctgccatacgggtagctggacctatataacggatctaa tcctccttggtaactgctcctcacaggttctctgtgcgtagccagggagt cctggataagctgttgagcagattgtacctgggacgatgtcccctttatt tcaacagttatatcatcagggcttcccaaactctcttgaattgtgacaac agcaccactgttagcccgtatgtatgcaatgtttgctcctttgactccta tgatatcttctgcataggtaagtgggatttgcatggtttgtgttatctgt gtaagtagagggccagcaccatgcattccagaangtcgtaatgctgacaa ggcaggatctcgcccatataatgacacacctgagcg
Download
page-top