Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ318161
Length 616 bp
Fasta Format > rwhyf10e03
cagccctgactggcccgttcatcaaaccaatgaaagtgccactacaacta ggcaattacatacaggatccaaacaaccaaatctcctcatcctctccctg atatggacctaagtaatgtcacgacagtagtctatgggggcggctactcc ttggcagcgaccttcttcttgggggacttggtggaggtcttcttcttggg cgacttggcctccttctcggcggcgacgggggacttcttggggagcagca cggagttaatgttggggatcacgccgccgtgggcgatggtgacgccggcg agcagcctgccgagctcctggtcgttgcggacggcgagcagcaggtggcg cgggatgatgcgggtcttcttgttgtccttggccgcgttgccggcgagct ccaggacctcagcggcgaggtactcgaggacggcggcgaggtagacgggg gcgccggagccgacgcgctgggcatagcggcccttcttgaggtagcgccc gatgcggccgacggggaactggagcccggccttgacggacctggtcaccg ccttcttcctgtcgcctnccttccttccggccatcttcttgctccttctn cggcgagctggaaact
Download
page-top