Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ318155
Length 459 bp
Fasta Format > rwhyf10d13
gatttgaaattaaaaaactcctnatcttcttgtcaacacacacatacata catacacatgatgatgatccgaaaaacctctccctgcaaatcaaatcatt acagatagacgcttattcagtgaatgaataaacaaatcaaataggaatac aaatcaaatcaaatggatccacacaacacaacacacattctacgttcctt tgactcaacaaacacaacgaatcccgctctgctctgctctgtttcagaca aataatctcctttccatgatgtcacacgagcgccgagtcccgtccctcgg taccaccttccacggccgcctgccgcaccttgggaggcccagagtgccgt ctcgccgccgccgacggcaccggcggcggcgtcccagccggaaaggacag cctcttcttcgctgaacccacagaagaccatcctttctccagcgtttcag catgagcac
Download
page-top