Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ318151
Length 187 bp
Fasta Format > rwhyf10d08
gacatatactctattgttgaaagaggataaaacagtagtgagcctcttag acgaaagtgcagatcaaacagaaatcatccagcttgagtacaggcaaaac tgacaaagcatttcggtttctaggtaacatacatatccagcaaccaggtg aacttcattaactcaaggtctaaagagagctacgtcc
Download
page-top