Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ318142
Length 110 bp
Fasta Format > rwhyf10c15
acccctatgatngtaatgttttgagaacgctgccgccaacctacgacaac ctctggagttcgatgcctccaccaaaaacgaatgttgggaaaatccaccc tctacagaaa
Download
page-top