Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ318140
Length 640 bp
Fasta Format > rwhyf10c12
ttacgcgaggtactgatggttacgagtgcacattacaaagttccactgta caccttgtgtgcgctaccaataacagtacaaattccagttcaaaataaca atacaaatgaaaatgtttaggccgccgtagacgggccaaacacttcttat ttgacgtgcagaactcaaactacaatgcagggaggcttttcaaatttcaa gtgcagatgtttcattgacgacgctcggtctggactgcgcacggctcact gccgcattcaggtagatttcttgctctcctgcaggcgctcgaacaggctg ccatcgaaggcgcccctcacgatttctcgctgtaaaaagccttctttatc ctttgccactttgtgcagcagcttccattcgaggttggctgcggcccagc ccaggaaatcatacatattgcggttgtgtttaagcatggcgttgatctca tcttctgacaaagcattcggccgagttttgccaaacttgctgaatatagc atcgaatttcgctggttcaaacctcccttcagtgtcatacgtctcagagt cgctcccgtgcttgcccctgtggatgttctttatatggatcgagagcaga ggggaaggcatccatcccggttgagtaggataagtgagga
Download
page-top