Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ318131
Length 619 bp
Fasta Format > rwhyf10b21
gtttaaaagacaaacgggacacatctaaatgagttcgattctcgataggt aggtaaaaagagcagagcaaacgcgagccacctctaagccttctggttgt agacgtaggtgaggccgcacttgccgcagtagtggcggtcgaagtggttg gccatgaaggtgccggcgccgcagtcggcgttggggcactccttcctgag cctggtcaccttgccggtggcgtcgtcgaccttgtagaactggaggacgg cgagcttcaccttcttgtgcttgtgcttttgcttcttgggcttggtgtag gtcttcttcttgcgcttcttggcgccgccgcggaggcggagcaccaggtg gagggtggactccttctggatgttgtagtcggcgagggtgcggccgtcct cgagctgcttaccggcgaagatgaggcgctgctggtccggcgggatgccc tccttgtcctggatcttggccttgacgttgtcgatggtgtccgaggactc cacctccagcgtgatggtcttgcccgtcagggtcttcacgaagatctgca tcttggcggcggtgcgaggtcgcctccgcgcgctgcggcggcgacggcgg cggcggggtagggtttggc
Download
page-top