Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ318129
Length 660 bp
Fasta Format > rwhyf10b17
tnttttaaattacnccaaggncctctgccctccctctctatctatccaag agatggaagggcagagcttttttttggttttttcatcttttcatcaaaga gttgaacaatgaagatagatggcaagtgcctgatcgatttgatcaggccg tgtaggaacaaggttcaaatcgttcgttcgttaggatgcctcagctgcat acatcactgcacttccacttgacacctatttaaacggctcgtctcgccgc taccttatcctatttccatacttctgtcgctccatccccgtatgggtgga gaacccgtcgctgtctcggctgtgataccggaggctctagggaagtcgga ggagagagcactcatcttggggtgggcttactacttatatgctttcagca gttatcctctccgcacttggctacccagcgtttaccgtaggcacgataac tggtacaccagaggtgcgtccttcccggtcctctcgtactagggaaaggt cctctcaatgctctaacgcccacaccggatatggaccgaactgtctcacg acgttctgaacccagctcacgtaccgcattaatgggcgaacagcccaacc cttggaaccacctacagcttctctctctctctctctctctctctctctnt ntctntntnt
Download
page-top