Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ318127
Length 492 bp
Fasta Format > rwhyf10b15
ttgcacttaggtaggattagaacagaactagtttattgaccgcaacaagg aattacagcctaatgaacacaagacggaacacaacgacgcacgccaaagc agtagtaaaacccgtcttccacagaacacacggacacacgacacgaatct agccgccgaagccgtagagggtgcggccctggcgcttgagcgcgtagacg acgtccatggcggtgacggtcttgcggcgagcgtgctcagtgtaggtgac ggcgtcgcggatgacgttctcgaggaagatcttgagcacgccgcgggtct cctcgtagatgagccccgagatgcgcttcacgccgcccctcctggccagc ctccggatcgccggcttggtgatgccctggatgttgtcgcggagcacctt ccggtggcgcttggcgccgcccttccccagccccttgccgcccttgccgc gccccgacatcgccgatccacctagctccgagggatgtgtgc
Download
page-top