Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ318122
Length 657 bp
Fasta Format > rwhyf10b07
caccggcaggaataaactaaatatttagtttcaactcataacctccatcc agaaaagtaacacgaacaaaataagatagctgaacgctggctaggaatgt cgacacaagtactcaagaaatcagccatcaaaactgactacaaagttcac gacaccaagtggcacatatatcatcttctagatatgaagcagcaaaatag cgacttctattctctactcagcagcagcaacctcctccgcaccaggaatg acctcgtccccatcagcaggcctgtcaagcttcacaccaacatcctcctt gtagtcaccgtgaacctccatgagcttccccaggtcgaacttgggggcct tcaggatcttcaccttgcggacgtacacgttctggagggggaagatgctt gaggtagccttctcaatctcctttccgatcacctcagggatgaacttgtt cacaagctccttcaagtcacagcttgcagcttggttgaccatgatctcaa ccatcttgcggcggatctgtctgatctgacttgcttgggcatagcaagtg cgcttcacctggttcgggcgtctcttggtgaagccaatggcgaacatgcg aagcatgtagttgtcagttgtcttcacatccacatgagcctcaatgagtg tctgcca
Download
page-top