Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ318116
Length 624 bp
Fasta Format > rwhyf10a22
acttgataacgctaggtcatnccgcatgttcgtcgagcggaagaggctgc ccttttattacatcatcacacacagaccattgctactacacaaggtttgt tttattacaatcacacagaccattgctaacataaggtttgcctcctcgcg acacaatttgagcctgctcgtcttcagtggagttccttgaggaagtccgc atgatccaccagaaccactttccagccatctgggtcaaggaaagaggtga ttttggtgttcagccctggcagtggccctggctgccttagaatcttccca cctagttctttggtaaccagctcaactgcttcggcgctcttgtacacatc gtcagtgccaatagcaacctgagcatatgcattgcccttgttatattccg tgacaccatagttgtatgtcaactccagaacagtggtcttgtcctcctca gcatagcccatcatggcaatagtgtacttatactgaggcacatccttctt cctcagaagcttcatcccaagggccttctcgtagaacatgatagcccgat caaggtcaccaacacgaagcataacttgacagagaggctcaggcgtcgga cccctctggataagctcaaacatg
Download
page-top