Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Accession HX087078
Length 582 bp
Fasta Format > whxp_27079_b17f
TCCTCCCCCTCCTAGGGGATCGCCGGAGAGGAATCGCGACGAGGGCTTCC TCCTATCAGTTAAATCAAAGCCATGGAGCACAAGGAGACCGGCTGCCAGT CTCGGGAGGGTCCCATCCTTTGCGTCAATAACTGCGGATTCTTTGGCAGT GCGGCGACCATGAACATGTGCTCCAAGTGCCACAAGGAGATGGCGATGAA GCAGGAGCAGGCCAAGCTGGCTGCCTCCTCTTTCGACAGCATCGTCAACG GTGGCGATGCCGCGAAAGAACACCTTGCTGCTGGCAGCACGGCGGTGGCA GTTGCTCACGTTGAGGCGAAGACGCTTATTACCGCACAGCCTGCTGATAT CGCCGGTCCCAGCGAGGCGGCGATGGAGAACCCCAAAGGCCCAAGCCGGT GCAGCACCTGCAGAAAGAGGGTTGGGCTGACCGGATTCAACTGCCGGTGC GGGAACTTGTACTGCGCGACGCACCGTTACTCGGACAAGCACGAGTGCAA GTTTGACTACCGCGCCGCGGCCATGGACGCCATCGCCAAGGCCAACCCGG TGGTGAAGGCGGAGAAGCTCGACAAGATCTAG
Download
page-top