Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ313206
Length 311 bp
Fasta Format > whyf4c05
ggcccaggccgccaaggttgccaaggctgtgaagtctgggtcaatcaaga agacggcaaagaagatccgcacttctgtgacatttcaccgccccaaggac cctgtccaaggccaggggaccccaagtaccccagggatcagcacccctgg ggaggaacaagctcgatcaatatcagatcctcaagtacccgcttaccact gagtctgcaatgaagaagatcgaggacaacaacacactcgtcttcatcgt cgacctgaaggccgacaagaagaagattaaggccgctgtcaagaaaatgt acgacattcag
Download
page-top