Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ317449
Length 644 bp
Fasta Format > whyf28d09
gggcgaaaacaaaancagctcaggcccggcccgatcccggatcttcgccg ccggcgacgccggttggagaggtgatgggggaggtgcgcggtgctctata gtatctagtaggtgtagttctagtttttccttagaggagtttggcctagt gccggagattggcgtcatgccgatgaggattttgctgtcggcgcgcccga gccgcgttcggtggttcctggcgatgctcttgttggtggtggcggttggc tcgctgctgctggaagcaggcgcgctggaatcctcggaaataagctcgat gtctcccctggtatgcaggaatccccttcgcttgctctcgccgacggcag tcaccatggtggtggtcaagtcgacagggactggtatgaagactgttctt gcgaccggttccagagcaaatcatcgatggtgcttgagctttggcgctcc cggcggacagccggcttgcagcgccgccgcgccaccgaatcctctggccg aagggcggccaaacctcttcctcctagccttgaagctatatgggaggcag tgctactctagatcgatgttcatggcttgctgcggtgaagaactcgtcgg accaagtgggtgatgtccccggagccggcgagttttggagtcga
Download
page-top