Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Accession HX073854
Length 705 bp
Fasta Format > whxo_17046_c11f
TACCTACATAGCACAGCCATGGCCCCCACCGTGATGGCCTCGTCGGCCAC CTCCGTCGCTCCTTTCCAGGGGCTCAAGTCCACCGCCGGCCTCCCCGTCA GCCGCCGCTCCAACGGCGCTAGCCTCGGCAGCGTCAGCAACGGTGGAAGG ATCAGGTGCATGCAGGTGTGGCCCATCGAGGGCATCAAGAAGTTCGAGAC CCTGTCCTACCTGCCACCGCTCAGCACGGAGGCCCTCCTCAAGCAGGTCG ACTACCTGATCCGCTCCAAATGGGTGCCTTGCCTCGAGTTCAGCAAGGTT GGGTTCATCTTCCGTGAGCACAACGCATCCCCTGGGTACTACGATGGCCG GTACTGGACAATGTGGAAGCTGCCTATGTTCGGGTGCACCGACGCCACAC AGGTGATCAACGAGGTGGAAGAGGTCAAGAAGGAGTACCCTGACGCGTAC GTCCGCATCATCGGATTCGACAACATGCGCCAGGTGCAGTGCGTCAGCTT CATCGCCTTCAAGCCACCGGGCTGCGAGGAGTCCGGCAAGGCCTAAACAG CTCACTCACCACGGGCCACATATAAAGTGCCATTGCGGTTTTGTCAACTC TGACATTGCTTTGGGTTTTCCTTCTCCATTTATCTTTCTTGTTTGTTCCT AAGNNTATGTGTATGTCCATGTTCATGTACCAACATGTCTCGAGAAAGCA TGCTC
Download
page-top