Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Accession HX071965
Length 510 bp
Fasta Format > whxo_12015_a02r
AAGCAAATGATTGAGTGGCTTTGGTTGCACTTCTAGAGTAGCTTCCCCCG AAAAAAAACAGAGCAAACTAGTGTTAGGCAACGCTATTACTTCTAACCTT TCATACTTGACCACAAACCTAAAACCATTCACTGCCTTTATTTTCACATA TCATGGCATTGTAGGGAATGAACTATGCTTCCACATTACATATTGTTGGG GATATAACCCCGTGATGTGACCCGCCCAGGTGGGGCCGGGTTACACTATT GGTGACTCAATAGTAAGGGCTTAAGTGGGCCTATGAAGATGAGATATGAA GACTGGAGGCGGCTTACAAGGCGGGCCTATTAAAGGCCCAAGACCCAGAG GGGGTGCTGTAACCCGGAGATGTGAGCCGCCACATGGCGACTTGCCTAGC AACGCAAGGTGGCTTATAACCCGAGTTGGTCACGTCGTGTGATCCGATTA GGACTCTTGTAAGCCAAGGGCCTCGACCTGTGTATATCAAGGTGAGACCC TCGTGAGTGA
Download
page-top