Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ316383
Length 642 bp
Fasta Format > whyf22n10
gcggcgaggagcacgggaagggaggcggaactcgggagaggagatgggtg cgccgaagcagaagtggacgtcggaggaggaggaggcgctgcggcgcggc gtgctcaagcacggcgctggcaagtggcgcaccatccagaaggatcccga gttcagccccgtcctctcctcccgctccaacatcgacctcaaggacaaat ggaggaatttgagttttagtgcaagtggactgggttcaagggataaacta agggttccgaggccgaaagcaccttcgtcctccccatcacctagcccgca gcttctgcttctctcagccccgaataatgttgccgaggcttctccaccag aagattgtgaaaaaagcccacaggatgacaagactccgagtccaaagttg tacagttccatgatcctggaagctctcgacgaactgaaagagccaaatgg ttcagaagttgctacaatttgcaatttcatagagcaaaggcatgaggtgc aaccaaattttagaaggttgctttgtgccaaattacgaaggcttataggc gtgaacaaagttgagaagattgataagtcctataagctgacggattcata tgcaaaaagggctctggctccaatgaaagatccatctctaaa
Download
page-top