Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ315777
Length 290 bp
Fasta Format > whyf20b10
tgcgtgagatcgctgaggcttacctaggagtaactattaagaatgctgnt gtcaccgtgcctgcttacttcaatgattcccagaggcaggcaaccaagga tgccggtgttattgctggtcttaatgtgatgcgtatcatcaacgagccaa cagcagctgcaattgcttatggtcttgacaagaaggctaccagngtcggn gagaagaatgtgcttatctttgaccttggtggtggcacttttgatgtctc tctccttaccattgaggagggtatttttgaggtgaaggcc
Download
page-top