Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ315249
Length 643 bp
Fasta Format > whyf16h16
gctgagaagctcaaatggctcccaaagttgctgttgccaagaagggcgat gccaaggcccaggccgccaaggttgccaaggctgtgaagtctgggtcaat caagaagacggcaaagaagatccgcacttctgtgacatttcaccgcccca agaccctgtccaaggccagggaccccaagtaccccaggatcagcacccct gggaggaacaagctcgatcaatatcagatcctcaagtacccgcttaccac tgagtctgcaatgaagaagatcgaggacaacaacacactcgtcttcatcg tcgacctgaaggccgacaagaagaagattaaggccgctgtcaagaaaatg tacgacattcaggccaagaaggttaacaccctcatcaggcctgatggcaa gaagaaggcgtacgtgaagctgacaccagactacgatgctcttgatgtgg ccaacaagatcggcatcatataagtcagagggagggtcctgcagtaggcg cttgtgtcgtggtttcttatgttattggaattttgtagttgttacttagc aaaggggctcggtggctccattgcctaccatatcgccgcacactttcatg aatttgatgcaatcgaagtgacttgttgatgctaanaaaaaaa
Download
page-top