Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ314951
Length 454 bp
Fasta Format > whyf15c14
caccggcggcggcgcagcgcagcttgaggaaggaagcgaagatggtgaag ttcctgaagcccggcaaggcggtgatcctgctgcagggcaggtacgcggg gaagaaggcggtgatcgtgcgcgtgttcgaggagggcacccgcgaccgcc cgtacgggcactgcctcgtcgccgggctggccaagtacccgaagaaggtg atccgcaaggactcggccaagaagacggccaagaagtcccgcgtcaaggt gttcctcaagctcgtcaacttcacccatctcatgcccacccgctataccc tcgacgtcgacctcaaggaggtggcctccggcgcgcccgactccctcacc tccaaggacaagaaggtgggcgccgccaaggccgccaaggccaagctcga ggagaggttcaagaccggcaagaacaggtggttcttcaccaagctccgct tcta
Download
page-top