Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ314807
Length 420 bp
Fasta Format > whyf14g20
gcagatcctcaagtacccgcttaccactgagtctgcaatgaagaagatcg aggacaacaacacactcgtcttcatcgtcgacctgaaggccgacaagaag aagattaaggccgntgtcaagaaaatgtacgacattcaggccaagaaggt taacaccctcatcaggcctgatggcaagaagaaggcgtacgtgaagctga caccagactacgatgctcttgatgtggccaacaagatcggcatcatataa gtcagagggagggtcctgcagtaggcgcttgtgtcgtggtttcttatgtt attggaattttgtagttgttacttagcaaaggggctcggtggctccattg cctaccatatcgccgcacactttcatgaatttgatgcaatcgaagtgact tgttgatgctaaaaaaaaaa
Download
page-top