Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312513
Length 605 bp
Fasta Format > whyf10i03
cggcacgaggnatttgcaaggatgtgttcttcgtacttgaccgtgcaatc atatgcaatgatgtgtcttctcgtcaggtagaagtagccggctggagatc gagcgagcatggacgactcgaacatgttcatccagtgggcaatggagacg cttgagcaggagcaggacggcgccgccaccggacacgtcttcccgtcgtc agtcctggagctcgacaactcggcggcgccgcagaacggcacgcacatgg cggcctaccgacacagagccacggacagctggagctcaggcgacagtggc gccgcggtggccgtggagaacgacggctggtcgtccaactgcagtaccaa ccacccggccgcgagctggaacttcacctcggtcataccgcatccgccca gcattatcgaggaggccaccccgagcccacccgcagctcccagccacgtc gtgccggagatggcgcagaggtcgccgcagtcgaggaaatcctcaggcgc cagtacagggatggtgccgaccgtgcaggaacacgtcatggcggagcgga agcgccgggagaagatcaaccgacgcttcatcgagctctccaccgtcatc cccgg
Download
page-top