Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312512
Length 615 bp
Fasta Format > whyf10h22
gcatttgcaaggatgtgttcttcgtacttgaccgtgcaatcatatgcaat gatgtgtcttctcgtcaggtagaagtaaccggctggagatcgagcgagca tggacgactcgaacatgttcatccagtgggccatggagacgctggagcag gagcaggacgccgccgccgccgccggagatgttttcccgtcgtcactcct agagctcgacaacccggcggagctgcagaacggcacgcacatggcggccc accgacacggagccaccgacagctggagctcaggcgacagcggcgccgca gtggccgtggagaacgacggctggtcgtccaactgcagcaccaactaccc ggccgcgagctggaacttcacttcggccataccacagccgcccagcatta tcgaggccaccccgagcccacccgcagctcccagccacgtcgtgccggag ctggcgcacaggtcgccaccgtcgaggaaatcctccggcgccagtacagg ggcggtgccgaccgtgcaggaacacgtcatggcggagcggaagcgccggg agaagatcaaccggcgcttcatcgagctctccaccgtcatccccagcctg aagaagatggacaag
Download
page-top