Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ312508
Length 657 bp
Fasta Format > whyf10h17
caggaattcggcacgaggctcatcatcgtcctctcctctcccctgccgcc gccgcgccccgcaaaccctacccctcctcctcgctccccggcccgccgcc cgccgccgcgtcgccatgagtcgtcaacctgaggtgctctgggctcaacg ctcggaaaaggtttacctgactatctcagtcccagacgcagaagatgttg tgatcaagactgaacctcagggaatctttagcttctcagctgttgctcat ggggaatcttttagcttgaatttggagctatttgattccgtactgcctga gggaagcaaaacaaagacaaaggtgggttcgcgaaacataatctgttcga tccagaaagataagaaatgttggtggaagcgcttgctgaagtcagaggca aaacatccatacatcaaagttgactggaacaaatggtgcgatgaggatga agagtctgagaattcgggttcagacgatgactttgatggtggtgaggaaa atgacgaaagcgatgctgatgatggaatgctgtatctccctgaccttgag aagctgagagggaaatgagcaggcaggatatatgaaggaagtaggttgtg ctgctgtagcaagtaggcaatcgttaacgctatatagcaagtaaccgtta gcgctag
Download
page-top